Basic information from miRBase |
hairpin accession number: MI0015557 |
Located between position 845403 and 845456 on chromosome scaffold_44 strand + |
mature miRNAs for MI0015557: |
cin-miR-4013a-5p (MIMAT0016514): AGACTTGTAATAGCAGCATG |
cin-miR-4013a-3p (MIMAT0016515): TAGGCTGCTAATGCAAGCCC |
You can find this miRNA in ENTREZGENE: mir4013a (accession: 100498900) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |