| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005823 |
| Located between position 12460004 and 12460100 on chromosome 2L strand - |
| Overlapping with sense strand of bun-RC (intron 1). |
| (Ensemble: FBtr0299657) (FlyBase: FlyBase) |
| mature miRNAs for MI0005823: |
| dme-miR-967-5p (MIMAT0005482): AGAGATACCTCTGGAGAAGCG |
| dme-miR-967-3p (MIMAT0020863): CTTTTCCACCTAGGTGTCTCTCT |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| more data |
| Data from CoGemiR |