miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0008204

Located between position 6660445 and 6660503 on chromosome IV strand -

Overlapping with sense strand of Y73B6A.13 (exon 1).

(Ensemble: Y73B6A.13) WormBase: WormBase)

mature miRNAs for MI0008204:

cel-miR-1834* (MIMAT0020361): GACTCGGTGTGTGATCTCTTA

cel-miR-1834 (MIMAT0006776): AGAGATCAACCATTGAGATCCAA

References

[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep"

[2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"

[3]Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"

more data

Data from CoGemiR