| Basic information from miRBase |
| hairpin accession number: MI0016071 |
| Located between position 18499555 and 18499619 on chromosome 16 strand - |
| Overlapping with sense strand of NPIP-201 (intron 3). |
| (Ensemble: ENST00000432470) |
| mature miRNAs for MI0016071: |
| hsa-miR-3670 (MIMAT0018093): AGAGCTCACAGCTGTCCTTCTCTA |
| You can find this miRNA in ENTREZGENE: MIR3670 (accession: 100500910) |
| References |
| [1]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" |