| Basic information from miRBase |
| hairpin accession number: MI0008419 |
| Located between position 101474546 and 101474630 on chromosome 14 strand + |
| mature miRNAs for MI0008419: |
| ptr-miR-1185 (MIMAT0007953): AGAGGATACCCTTTGTATGTT |
| You can find this miRNA in ENTREZGENE: MIR1185-1 (accession: 100316044) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |