| Basic information from miRBase |
| hairpin accession number: MI0009959 |
| Located between position 142757845 and 142757965 on chromosome 7 strand + |
| Overlapping with sense strand of Ptpre-204 (intron 1). |
| (Ensemble: ENSMUST00000169654) |
| mature miRNAs for MI0009959: |
| mmu-miR-1962 (MIMAT0009435): AGAGGCTGGCACTGGGACACAT |
| You can find this miRNA in MGI: Mir1962 (accession: 3837207) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |