| Basic information from miRBase |
| hairpin accession number: MI0008402 |
| Located between position 93397543 and 93397628 on chromosome 9 strand + |
| mature miRNAs for MI0008402: |
| ptr-let-7d (MIMAT0007939): AGAGGTAGTAGGTTGCATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7D (accession: 100316035) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |