miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013750
Located between position 773412 and 773503 on chromosome 12 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018416)
mature miRNAs for MI0013750:
         tgu-let-7d (MIMAT0014536): AGAGGTAGTAGGTTGCATAGTT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"