| Basic information from miRBase |
| hairpin accession number: MI0008574 |
| Located between position 134536686 and 134536794 on chromosome 10 strand - |
| mature miRNAs for MI0008574: |
| ptr-miR-202 (MIMAT0008064): AGAGGTATAGGGCATGGGAA |
| You can find this miRNA in ENTREZGENE: MIR202 (accession: 100316522) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |