miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0009996
Located between position 449865 and 449954 on chromosome nscaf2053 strand +
mature miRNAs for MI0009996:
         bmo-miR-190 (MIMAT0009153): AGATATGTTTGATATTCTTGGTT
         bmo-miR-190* (MIMAT0015287): CCCGGGAATCAAACATATTACTCT

References
[1]Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[2]Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y, Insect Biochem Mol Biol. 38:1066-1071(2008)., "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
[3]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"