miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006228
Located between position 432487 and 432679 on chromosome scaffold_40 strand -
mature miRNAs for MI0006228:
         cre-miR1168.1 (MIMAT0005424): TGTGGACAAGGCCAAGTCCGA
         cre-miR1168.2 (MIMAT0005425): AGCACGGAAGGCGAAGA

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"