| Basic information from miRBase |
| hairpin accession number: MI0008594 |
| Located between position 56527994 and 56528080 on chromosome 20 strand - |
| mature miRNAs for MI0008594: |
| ptr-miR-298 (MIMAT0008081): AGCAGAAGCAGGGAGGTTCTCCCA |
| You can find this miRNA in ENTREZGENE: MIR298 (accession: 100316128) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |