| Basic information from miRBase |
| hairpin accession number: MI0002755 |
| Located between position 89860535 and 89860615 on chromosome 10 strand - |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSPTRT00000005174) |
| mature miRNAs for MI0002755: |
| ptr-miR-107 (MIMAT0002459): AGCAGCATTGTACAGGGCTATCA |
| You can find this miRNA in EMBL: AY866106 (accession: AY866106) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |