miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004736
Located between position 2864127 and 2864198 on chromosome 20 strand +
Overlapping with sense strand of PANK3_BOVIN (intron 5).
(Ensemble: ENSBTAT00000015780)
mature miRNAs for MI0004736:
         bta-miR-103 (MIMAT0003521): AGCAGCATTGTACAGGGCTATGA
You can find this miRNA in ENTREZGENE: MIR103-1 (accession: 790976)

References
[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
[2]Gu Z, Eleswarapu S, Jiang H, FEBS Lett. 581:981-988(2007)., "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"