| Basic information from miRBase |
| hairpin accession number: MI0002743 |
| Located between position 164939534 and 164939611 on chromosome 6 strand - |
| Overlapping with sense strand of (intron 6). |
| (Ensemble: ENSMMUT00000017557) |
| mature miRNAs for MI0002743: |
| mml-miR-103 (MIMAT0002447): AGCAGCATTGTACAGGGCTATGA |
| You can find this miRNA in EMBL: AY866094 (accession: AY866094) |
| References |
| [1]Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain" |
| [2]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |