| Basic information from miRBase |
| hairpin accession number: MI0007611 |
| Located between position 37253045 and 37253122 on chromosome 10 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSMMUT00000028048) |
| mature miRNAs for MI0007611: |
| mml-miR-103 (MIMAT0002447): AGCAGCATTGTACAGGGCTATGA |
| You can find this miRNA in ENTREZGENE: MIR103-2 (accession: 100315509) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |