| Basic information from miRBase |
| hairpin accession number: MI0002742 |
| Located between position 170805656 and 170805733 on chromosome 5 strand - |
| Overlapping with sense strand of XM_518087.2 (intron 5). |
| (Ensemble: ENSPTRT00000032369) |
| mature miRNAs for MI0002742: |
| ptr-miR-103 (MIMAT0002446): AGCAGCATTGTACAGGGCTATGA |
| You can find this miRNA in EMBL: AY866093 (accession: AY866093) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |