| Basic information from miRBase |
| hairpin accession number: MI0010843 |
| Located between position 23402957 and 23403042 on chromosome 17 strand + |
| Overlapping with sense strand of pank1a-001 (intron 5). |
| (Ensemble: OTTDART00000028572) |
| mature miRNAs for MI0010843: |
| dre-miR-107b (MIMAT0011301): AGCAGCATTGTACAGGGCTTT |
| You can find this miRNA in ENTREZGENE: mir107b (accession: 100310770) |
| References |
| [1]Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA, BMC Genomics. 10:195(2009)., "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" |