Basic information from miRBase |
hairpin accession number: MI0015556 |
Located between position 366261 and 366319 on chromosome scaffold_67 strand - |
Overlapping with sense strand of (intron 8). |
(Ensemble: ENSCINT00000027530) |
mature miRNAs for MI0015556: |
cin-miR-4012-5p (MIMAT0016512): AAGCTTATGTTCATGTATGC |
cin-miR-4012-3p (MIMAT0016513): AGCATTATGTATGTGAGCT |
You can find this miRNA in ENTREZGENE: mir4012-2 (accession: 100499102) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |