| Basic information from miRBase |
| hairpin accession number: MI0013069 |
| Located between position 123132 and 123213 on chromosome Un.004.152 strand + |
| Overlapping with antisense strand of MOV10L1 (intron 18). |
| (Ensemble: ENSBTAT00000027109) |
| mature miRNAs for MI0013069: |
| bta-miR-2894 (MIMAT0013852): AGCCCTGGCCCTGCCATCGTG |
| You can find this miRNA in ENTREZGENE: MIR2894 (accession: 100498849) |
| References |
| [1]Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D, BMC Genomics. 10:443(2009)., "Identification and characterization of miRNAs expressed in the bovine ovary" |