Basic information from miRBase |
hairpin accession number: MI0008587 |
Located between position 46054683 and 46054791 on chromosome X strand - |
mature miRNAs for MI0008587: |
ptr-miR-221 (MIMAT0008076): AGCTACATTGTCTGCTGGGTTTC |
You can find this miRNA in ENTREZGENE: MIR221 (accession: 100316453) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |