| Basic information from miRBase |
| hairpin accession number: MI0015494 |
| Located between position 43751 and 43803 on chromosome scaffold_475 strand + |
| Overlapping with sense strand of (intron 8). |
| (Ensemble: ENSCINT00000019672) |
| mature miRNAs for MI0015494: |
| cin-miR-4220-5p (MIMAT0016419): TAGTGCAATTTGTTGTAGCTTG |
| cin-miR-4220-3p (MIMAT0016420): AGCTCAATTCAATTGCACTG |
| You can find this miRNA in ENTREZGENE: mir4220 (accession: 100499020) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |