miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015909
mature miRNAs for MI0015909:
         ssc-miR-133a-5p (MIMAT0015299): AGCTGGTAAAATGGAACCAAAT
         ssc-miR-133a-3p (MIMAT0010186): TTGGTCCCCTTCAACCAGCTG
You can find this miRNA in ENTREZGENE: MIR133A-2 (accession: 100526378)

References
[1]Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R, BMC Genomics. 10:65(2009)., "Cloning, characterization and expression analysis of porcine microRNAs"
[2]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
[3]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
[4]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome"