miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008539
Located between position 56292753 and 56292835 on chromosome 16 strand +
mature miRNAs for MI0008539:
         ptr-miR-138 (MIMAT0008034): AGCTGGTGTTGTGAATCAGGCCG
You can find this miRNA in ENTREZGENE: MIR138 (accession: 100316100)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"