Basic information from miRBase |
hairpin accession number: MI0008539 |
Located between position 56292753 and 56292835 on chromosome 16 strand + |
mature miRNAs for MI0008539: |
ptr-miR-138 (MIMAT0008034): AGCTGGTGTTGTGAATCAGGCCG |
You can find this miRNA in ENTREZGENE: MIR138 (accession: 100316100) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |