| Basic information from miRBase |
| hairpin accession number: MI0018030 |
| Located between position 52382288 and 52382361 on chromosome 7 strand - |
| Overlapping with sense strand of Rpl13a-010 (intron 4). |
| (Ensemble: OTTMUST00000042676) |
| mature miRNAs for MI0018030: |
| mmu-miR-5121 (MIMAT0020629): AGCTTGTGATGAGACATCTCC |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |