Basic information from miRBase |
hairpin accession number: MI0015569 |
Located between position 1539164 and 1539240 on chromosome 3p strand + |
Overlapping with antisense strand of (intron 5). |
(Ensemble: ENSCINT00000004458) |
mature miRNAs for MI0015569: |
cin-miR-4018b-5p (MIMAT0016530): AGGAACATTCTGTGGAACGG |
cin-miR-4018b-3p (MIMAT0016531): AGCTGTTTCACGGCGTTCCA |
You can find this miRNA in ENTREZGENE: mir4018b (accession: 100498906) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |