| Basic information from miRBase |
| hairpin accession number: MI0012701 |
| Located between position 102828539 and 102828622 on chromosome 4 strand + |
| Overlapping with sense strand of LOC100063539 (3UTR 4). |
| (Ensemble: ENSECAT00000016706) |
| mature miRNAs for MI0012701: |
| eca-miR-671-5p (MIMAT0012948): AGGAAGCCCTGGAGGGGCTGGAG |
| eca-miR-671-3p (MIMAT0012949): TCCGGTTCTCAGGGCTCCACC |
| You can find this miRNA in ENTREZGENE: MIR671 (accession: 100315004) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |