| Basic information from miRBase |
| hairpin accession number: MI0008812 |
| Located between position 13173968 and 13174060 on chromosome 12 strand + |
| Overlapping with sense strand of XP_001139700.1 (intron 1). |
| (Ensemble: ENSPTRT00000008706) |
| mature miRNAs for MI0008812: |
| ptr-miR-613 (MIMAT0008275): AGGAATGTTCCTTCTTTGCC |
| You can find this miRNA in ENTREZGENE: MIR613 (accession: 100316397) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |