Basic information from miRBase |
hairpin accession number: MI0003131 |
Located between position 95228174 and 95228289 on chromosome 12 strand + |
Overlapping with sense strand of KRT19P2-201 (3UTR 1). |
(Ensemble: ENST00000405395) |
mature miRNAs for MI0003131: |
hsa-miR-492 (MIMAT0002812): AGGACCTGCGGGACAAGATTCTT |
You can find this miRNA in HGNC: MIR492 (accession: 32081) |
References | ||||||||||||||
[1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" |
PROMOTER INFORMATION | ||||||||||||||
172 | chr12, 93561725-93562951, + | promoter sequence | Marson et al. | |||||||||||
945 | chr12, 93747305-93752420, + | promoter sequence | UCSC |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |
Polymorphism data from Patrocles |