Basic information from miRBase |
hairpin accession number: MI0008164 |
Located between position 36084815 and 36084874 on chromosome 9 strand + |
Overlapping with sense strand of XM_861763.1 (intron 1). |
(Ensemble: ENSCAFT00000027635) |
mature miRNAs for MI0008164: |
cfa-miR-1844 (MIMAT0006740): AGGACTACGGACGGGCTGAG |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" ![]() |