miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012743
Located between position 54764367 and 54764428 on chromosome 7 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSECAT00000005962)
mature miRNAs for MI0012743:
         eca-miR-492 (MIMAT0012920): AGGAGCTGCGGGACAAGATTCTT
You can find this miRNA in ENTREZGENE: MIR492-2 (accession: 100315052)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"