| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000346 |
| Located between position 3755135 and 3755228 on chromosome X strand + |
| mature miRNAs for MI0000346: |
| cel-miR-266 (MIMAT0000322): AGGCAAGACTTTGGCAAAGC |
| References |
| [1]Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs" |
| [2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" |
| more data |
| Data from CoGemiR |