miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0013119

Located between position 55826401 and 55826480 on chromosome 13 strand -

Overlapping with sense strand of (exon 1).

(Ensemble: ENSSSCT00000020265)

mature miRNAs for MI0013119:

ssc-miR-885-5p (MIMAT0013902): TCCATTACACTACCCTGCCTCT

ssc-miR-885-3p (MIMAT0013903): AGGCAGCGGGGTGTAGTGGAT

You can find this miRNA in ENTREZGENE: MIR885 (accession: 100498720)

References

[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[2]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"

[3]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome"