miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007158
Located between position 2152513 and 2152631 on chromosome 10q strand -
Overlapping with sense strand of (intron 2).
(Ensemble: ENSCINT00000011265)
mature miRNAs for MI0007158:
         cin-miR-34 (MIMAT0006094): AGGCAGTGTAGTTAGCTAGTTG
         cin-miR-34* (MIMAT0015252): AACTGCTTTTTGCACTACCACG
You can find this miRNA in ENTREZGENE: mir34 (accession: 100187694)

References
[1]Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T, BMC Genomics. 8:445(2007)., "Computational prediction and experimental validation of Ciona intestinalis microRNA genes"
[2]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica"
[3]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"


more data
Data from CoGemiR