miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0009930
Located between position 101199783 and 101199865 on chromosome 15 strand +
Overlapping with antisense strand of Krt80-201 (intron 1).
(Ensemble: ENSMUST00000077196)
mature miRNAs for MI0009930:
         mmu-miR-1941-5p (MIMAT0009405): AGGGAGATGCTGGTACAGAGGCTT
         mmu-miR-1941-3p (MIMAT0009406): CATCTTAGCAGTATCTCCCAT
You can find this miRNA in MGI: Mir1941 (accession: 3836979)

References
[1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model"
[2]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"