| Basic information from miRBase |
| hairpin accession number: MI0012884 |
| Located between position 42060853 and 42060951 on chromosome 24 strand + |
| Overlapping with sense strand of LOC100049905 (intron 3). |
| (Ensemble: ENSECAT00000013170) |
| mature miRNAs for MI0012884: |
| eca-miR-342-5p (MIMAT0013136): AGGGGTGCTATCTGTGATTGAG |
| eca-miR-342-3p (MIMAT0013137): TCTCACACAGAAATCGCACCCGT |
| You can find this miRNA in ENTREZGENE: MIR342 (accession: 100314902) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |