miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012884
Located between position 42060853 and 42060951 on chromosome 24 strand +
Overlapping with sense strand of LOC100049905 (intron 3).
(Ensemble: ENSECAT00000013170)
mature miRNAs for MI0012884:
         eca-miR-342-5p (MIMAT0013136): AGGGGTGCTATCTGTGATTGAG
         eca-miR-342-3p (MIMAT0013137): TCTCACACAGAAATCGCACCCGT
You can find this miRNA in ENTREZGENE: MIR342 (accession: 100314902)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"