| Basic information from miRBase |
| hairpin accession number: MI0008773 |
| Located between position 134511165 and 134511259 on chromosome 1 strand - |
| Overlapping with sense strand of XM_513861.2 (intron 21). |
| (Ensemble: ENSPTRT00000002622) |
| mature miRNAs for MI0008773: |
| ptr-miR-555 (MIMAT0008236): AGGGTAAGCTGAACCTCTGAT |
| You can find this miRNA in ENTREZGENE: MIR555 (accession: 100316488) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |