| Basic information from miRBase |
| hairpin accession number: MI0015546 |
| Located between position 2148360 and 2148421 on chromosome 10q strand - |
| mature miRNAs for MI0015546: |
| cin-miR-4008b-5p (MIMAT0016497): TGGCAGTGATCGCAAGTTAG |
| cin-miR-4008b-3p (MIMAT0016498): AGGGTCTAGCCTGCCTGCC |
| You can find this miRNA in ENTREZGENE: mir4008b (accession: 100499100) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |