| Basic information from miRBase |
| hairpin accession number: MI0008809 |
| Located between position 104677958 and 104678051 on chromosome 10 strand - |
| Overlapping with sense strand of XM_508019.2 (intron 3). |
| (Ensemble: ENSPTRT00000005569) |
| mature miRNAs for MI0008809: |
| ptr-miR-609 (MIMAT0008272): AGGGTGTTTCTCTCATCTCT |
| You can find this miRNA in ENTREZGENE: MIR609 (accession: 100316243) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |