| Basic information from miRBase |
| hairpin accession number: MI0017278 |
| Located between position 72162874 and 72162949 on chromosome 7 strand + |
| Overlapping with antisense strand of TYW1B-003 (intron 8). |
| (Ensemble: OTTHUMT00000347348) |
| mature miRNAs for MI0017278: |
| hsa-miR-4650-5p (MIMAT0019713): TCAGGCCTCTTTCTACCTT |
| hsa-miR-4650-3p (MIMAT0019714): AGGTAGAATGAGGCCTGACAT |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |