miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006227
Located between position 577911 and 578282 on chromosome scaffold_36 strand -
mature miRNAs for MI0006227:
         cre-miR1166.1 (MIMAT0005422): TGGACCTCGCGGCCCTGGAGG
         cre-miR1166.2 (MIMAT0005423): AGGTCCATGACCTCATGGG

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"