| Basic information from miRBase |
| hairpin accession number: MI0015748 |
| Located between position 76827 and 76892 on chromosome scaffold_158 strand - |
| mature miRNAs for MI0015748: |
| cin-miR-4191-5p (MIMAT0016809): AGGTTTATGATCGTAACAAT |
| You can find this miRNA in ENTREZGENE: mir4191 (accession: 100499137) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |