| Basic information from miRBase |
| hairpin accession number: MI0008782 |
| Located between position 116311035 and 116311137 on chromosome 3 strand + |
| Overlapping with sense strand of XM_001154447.1 (intron 4). |
| (Ensemble: ENSPTRT00000028438) |
| mature miRNAs for MI0008782: |
| ptr-miR-567 (MIMAT0008245): AGTATGTTCTTCCAGGACAGAAC |
| You can find this miRNA in ENTREZGENE: MIR567 (accession: 100316229) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |