| Basic information from miRBase |
| hairpin accession number: MI0008825 |
| Located between position 70413688 and 70413783 on chromosome 15 strand + |
| mature miRNAs for MI0008825: |
| ptr-miR-630 (MIMAT0008288): AGTATTCTGTACCAGGGAAGGT |
| You can find this miRNA in ENTREZGENE: MIR630 (accession: 100316252) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |