miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0009922

Located between position 21244591 and 21244678 on chromosome 11 strand -

Overlapping with sense strand of Ugp2-002 (intron 3).

(Ensemble: OTTMUST00000011701)

mature miRNAs for MI0009922:

mmu-miR-1933-5p (MIMAT0009396): AGTCATGGTGTTCGGTCTTAGTTT

mmu-miR-1933-3p (MIMAT0009397): CCAGGACCATCAGTGTGACTAT

You can find this miRNA in MGI: Mir1933 (accession: 3836970)

References

[1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model"

[2]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"