| Basic information from miRBase |
| hairpin accession number: MI0008815 |
| Located between position 32091712 and 32091807 on chromosome 12 strand + |
| Overlapping with sense strand of XM_509165.2 (intron 1). |
| (Ensemble: ENSPTRT00000047450) |
| mature miRNAs for MI0008815: |
| ptr-miR-616 (MIMAT0008278): AGTCATTGGAGGGTTTGAGCAG |
| You can find this miRNA in ENTREZGENE: MIR616 (accession: 100316246) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |