| Basic information from miRBase |
| hairpin accession number: MI0009952 |
| Located between position 138189385 and 138189449 on chromosome 3 strand + |
| Overlapping with sense strand of Eif4e-201 (intron 1). |
| (Ensemble: ENSMUST00000029803) |
| mature miRNAs for MI0009952: |
| mmu-miR-1956 (MIMAT0009428): AGTCCAGGGCTGAGTCAGCGGA |
| You can find this miRNA in MGI: Mir1956 (accession: 3837040) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |