miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0009950

Located between position 92032134 and 92032231 on chromosome 2 strand +

Overlapping with sense strand of Phf21a-007 (intron 2).

(Ensemble: OTTMUST00000034088)

mature miRNAs for MI0009950:

mmu-miR-1955-5p (MIMAT0009426): AGTCCCAGGATGCACTGCAGCTTTT

mmu-miR-1955-3p (MIMAT0017348): GAGCATTGCATGCTGGGACAT

You can find this miRNA in MGI: Mir1955 (accession: 3837036)

References

[1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model"

[2]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"