| Basic information from miRBase |
| hairpin accession number: MI0003256 |
| Located between position 41741794 and 41741897 on chromosome 19 strand - |
| Overlapping with sense strand of si:ch211-77k19.2-201 (intron 1). |
| (Ensemble: ENSDART00000051943) |
| mature miRNAs for MI0003256: |
| dre-miR-489 (MIMAT0002940): AGTGACATCATATGTACGGCTGC |
| You can find this miRNA in ENTREZGENE: mir489 (accession: 100033722) |
| References |
| [1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish" |