| Basic information from miRBase |
| hairpin accession number: MI0008765 |
| Located between position 30047084 and 30047179 on chromosome 7 strand - |
| mature miRNAs for MI0008765: |
| ptr-miR-550 (MIMAT0008230): AGTGCCTGAGGGAGTAAGAGCCC |
| You can find this miRNA in ENTREZGENE: MIR550-1 (accession: 100316220) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |